1. How many pieces would you have? Use the highlighter and forward to indicate answer.
GAAAAGCTTACAAGGCAGTCGACTTTTAAAAGCTTACATGC
CTTTTCAGCTGTTCCGTCATTCGAAAATTTTCAGCTTCGAA
ECHS Biology & Biotechnology with Mrs. Husselstein |
Warm Ups
The following DNA sequence is from a virus that is dangerous, scientists want to use a restriction enzyme to cut the virus into bits. They do not need sticky ends because the do not plan to combine it with other DNA. Use HindIII (A/AGCTT) to show how this DNA would be cut.
1. How many pieces would you have? Use the highlighter and forward to indicate answer. GAAAAGCTTACAAGGCAGTCGACTTTTAAAAGCTTACATGC CTTTTCAGCTGTTCCGTCATTCGAAAATTTTCAGCTTCGAA
0 Comments
Leave a Reply. |
Mrs. HusselsteinBiotechnology I Warm-Up questions. Please write your answers in the Warm-Up document provided weekly on Google Classroom. Archives
December 2018
Categories |