1. How many pieces would you have? Use the highlighter and forward to indicate answer.
GAAAAGCTTACAAGGCAGTCGACTTTTAAAAGCTTACATGC
CTTTTCAGCTGTTCCGTCATTCGAAAATTTTCAGCTTCGAA
ECHS Biology & Biotechnology with Mrs. Husselstein |
Warm Ups
The following DNA sequence is from a virus that is dangerous, scientists want to use a restriction enzyme to cut the virus into bits. They do not need sticky ends because the do not plan to combine it with other DNA. Use HindIII (A/AGCTT) to show how this DNA would be cut.
1. How many pieces would you have? Use the highlighter and forward to indicate answer. GAAAAGCTTACAAGGCAGTCGACTTTTAAAAGCTTACATGC CTTTTCAGCTGTTCCGTCATTCGAAAATTTTCAGCTTCGAA
0 Comments
1. In our DNA fingerprinting lab, what lane contains the standard?
2. What is the purpose of the standard? How will it help us in our analysis? 1. Explain what could happen if you take glassware that has been heated on a hot plate and dunk it in an ice bucket? What is the correct procedure/equipment used to cool liquids?
2. Explain what could happen if you are not wearing closed toe shoes while working with glass, or boiling liquids? 3. Explain what is expected of you before conducting a lab? Consider the two different samples of DNA shown below (single strands are shown for simplicity), both samples will be treated with the restriction enzyme EcoRI [recognition sequence GAATTC, cleaved between the G & A]
Sample 1: CAGTGATCTCGAATTCGCTAGTAACGTT Sample 2: TCATGAATTCCGTGGAATTCAGCAAATC 1. Determine the number of fragments and the size of each fragment from each sample of DNA. 2. List the fragment size in order (largest ——> smallest), for each sample. The line through the base pairs represents the sites where bonds will break if the restriction enzyme EcoRI recognizes the site GAATTC. 1. How many pieces of DNA would result from this cut? What difference do you notice? 2. DNA fragment size can be expressed as the number of base pairs in the fragment. What is the size of each fragment? |
Mrs. HusselsteinBiotechnology I Warm-Up questions. Please write your answers in the Warm-Up document provided weekly on Google Classroom. Archives
December 2018
Categories |